|
|
Shigella spp.
|
Table of Contents:
|
Taxonomy Information
- Species:
- Shigella. :
- Common Name: Shigella.
- GenBank Taxonomy No.: 620
- Description: In 1898, Japanese bacteriologist K. Shiga used bacterial culture to investigate an epidemic of acute dysentery in Japan. Using the serum from one of his patients, he was able to identify the epidemic agent in the feces of 34 out of 36 cases. Shiga characterized these bacteria by simple biochemical tests.The organism was named Shiga bacillus. Shigella spp. cause dysentery by invading the colonic mucosa. Shigella bacteria multiply within colonic epithelial cells, cause cell death and spread laterally to infect and kill adjacent epithelial cells, causing mucosal ulceration, inflamation and bleeding. Complications of Shigella infection are haemolytic-uraemic syndrome (HUS), seizures, sepsis, and toxic megacolon. Shigella infections are more severe in children who are malnourished and have a greater adverse effect on nutritional status than do infections with enteric pathogens that cause watery diarrhea. In several areas of the world, Shigella bacteria are resistant to available and affordable antibiotics(Website2).
- Variant(s):
- Shigella flexneri. :
- Common Name: Shigella flexneri.
- GenBank Taxonomy No.: 623
- Description: Simon Flexner, in the early 1900s, first isolated a mannitol-fermenting strain of Shigella from dysentery patients in the Philippines which has now been designated as Shigella flexneri. As it is a highly infectious pathogen, the infectious dose of S. flexneri is extremely low. Bacteria are spread by personal contact or exposure to contaminated food and water, creating severe outbreaks in areas of minimal sanitary conditions. S. flexneri is the predominant specie in endemic areas, accounting for approximately 50% of culture-positive disease(Website2).
|
Lifecycle Information
- Shigella Lifecycle Information
- Stage Information:
- Shigella lifecycle one stage(Website4, Website5, Website6):
- Shape: Shigella cells are rod-shaped.
- Picture(s):
-
SEM Image of Shigella dysenteriae (Website 63)

Description: Scanning Electron Micrograph of Shigella dysenteriae - Gram-negative, enteric, facultatively anaerobic, rod prokaryote; causes bacterial dysentery. This species is most often found in water contaminated with human feces. Magnification: x2,200.
-
SEM Image of Shigella sonnei (Website 63)

Description: Scanning Electron Micrograph of Shigella sonnei - Gram-negative, facultatively anaerobic, rod prokaryote; causes shigellosis (bacterial dysentery). This species is most often linked to infection from food. Magnification: x3,500.
|
Genome Summary
- Genome of Shigella flexneri.
- Shigella Chromosome
- GenBank Accession Number: AE005674
- Size: 4, 607 kb(Jin et al., 2002, Website40).
- Gene Count: 4,434 open reading frames(Jin et al., 2002, Website40).
- Description: There are several potential bacteriophage-transmitted PAIs (pathogenicity islands), many translocations, inversions and deletions of the corresponding E. coli DNA segments, and numerous pseudogenes. The presence of large numbers of pseudogenes has been postulated to be one of the main reasons that Shigella became a solely human pathogen(Jin et al., 2002).
- Shigella Plasmid pCP301
- GenBank Accession Number: AF386526
- Size: 221 618 bp(Jin et al., 2002).
- Gene Count: 267 open reading frames(Jin et al., 2002, Website41).
- Description: Shigella flexneri 2a strain 301 virulence plasmid pCP301(Jin et al., 2002, Website41).
|
Biosafety Information
-
General biosafety information
- Level: Biosafety Level 2.
- Precautions: Shigella may be present in feces, urine, and in food, feed, and environmental materials. Ingestion or parenteral inoculation are the primary laboratory hazards. The importance of aerosol exposure is not known. Recommended Precautions: Biosafety Level 2 practices, containment equipment, and facilities are recommended for activities with clinical materials and cultures known to contain or potentially contain the microorganism. Animal Biosafety Level 2 practices, containment equipment, and facilities are recommended for activities with experimentally or naturally infected animals(Website34).
|
Culturing Information
- Shigella Culturing Method :
- Description: Shigella Broth(Website35).
- Medium: BROTH BASE:Tryptone 20 g. K2HPO4 2 g. KH2PO4 2 g. NaCl 5 g. Glucose 1 g. Tween 80 1.5 ml. Distilled water 1.0 liter.Autoclave 15 min at 121 degrees celcius. Final pH, 7.0 0.2.NOVOBIOCIN SOLUTION:Weigh 50 mg novobiocin into 1 liter distilled water. Sterilize by filtration through 0.45 m membrane. Add 2.5 ml of this concentrated novobiocin solution to 225 ml base. Final concentration of novobiocin (0.55 g/ml).This broth is a specially formulated medium for Shigella, novobiocin is added to provide a selective environment.Pour supernatant into sterile 500 ml Erlenmeyer flask. Adjust pH, if necessary, to 7.0 0.2 with sterile 1 N NaOH or 1 N HCl. Place flask in anaerobic jar with fresh catalyst, insert GasPak and activate by adding water. Incubate jars in water bath for 20 h(Website35).
- Optimal Temperature: Incubate jars in 44 degrees celcius water bath(Website35).
- Optimal pH: Final pH 7.0 0.2(Website35).
|
Epidemiology Information:
- Outbreak Locations:
- Shigella is the primary causative agent of bacillary dysentery throughout the developing world. According to the World Health Organisation, the annual number of Shigella episodes throughout the world was estimated to be 164.7 million, of which 163.2 million were in developing countries (with 1.1 million deaths) and 1.5 million in industrialized countries. A total of 69% of all episodes and 61% of all deaths attributable to shigellosis involved children under 5 years of age(Kotloff et al., 1999). Shigella infection in the USA. A total of 59,527 cases of laboratory-confirmed Shigella infection were reported to the US National Shigella Surveillance System over the 5-year period 1990-94 (average 11,900 per year)(Kotloff et al., 1999). Over the same period, an additional 27,899 cases were reported from states not participating in the US National Shigella Surveillance System, yielding a total number of 87,426 Shigella cases for the USA, i.e. an average of 17500-18000 cases per year(Kotloff et al., 1999, Website9). This corresponds to 6.5 cases per 100,000 population(Kotloff et al., 1999). Shigellosis, which continues to have an important global impact, cannot be adequately controlled with the existing prevention and treatment measures(Kotloff et al., 1999).
- Transmission Information:
- From:
Humans(Website9, Website10, Mead et al., 1999). , To:
Humans(Website9, Website10, Mead et al., 1999).
Mechanism: Shigella bacteria are spread from one infected person to another through fecal-oral transmition. Shigella cells are present in the diarrheal stools of infected persons while they are sick and for a week or two afterwards. Persons who have a Shigella infection have Shigella bacteria in their stool and frequently have Shigella bacteria on their hands. Vehicles - food and water. Food prepared by this person may easily become contaminated with Shigella bacteria. Water usually becomes contaminated with Shigella bacteria when sewage enters the drinking water supply. Approximately 20% of cases of shigellosis are transmitted via contaminated food or water(Mead et al., 1999).
- Environmental Reservoir:
- Environmental Reservoir:
- Description: Humans are the only natural reservoir(Website22).
- Survival: Shigella may survive in faecally contaminated materials but not very long (Zaika, 2002). Shigella cells are known to survive in soiled linen for up to seven weeks, in fresh water from five to eleven days, in salt water for 12-30 hours, in dust at room temperature for six weeks, in sour milk for four weeks, and in kitchen refuse for approximately 1-4 days. Shigella survived for up to 14 days in tomato juice and apple juice stored at 7 degrees celcius. The shortest survival time (2-8 d) was observed in apple juice at 22 degrees celcius. Shigella cells were recovered after 48 h from strawberries and fruit salad kept at 4 degrees celcius (Bagamboula et al., 2002). Shigella organisms are killed by heat used in processing or cooking, and they do not survive well in acidic foods (pH below 4.5)(Website6, Website11, Zaika, 2002, Website17, Website26, Bagamboula et al., 2002).
- Intentional Releases:
- Intentional Release Information:
- Description: Shigella infection.
- Emergency Contact: If you believe that you have been exposed to a biological or chemical agent, or if you believe an intentional biological threat will occur or is occurring, contact your local health department and/or your local police or other law enforcement agency. CDC Emergency Response Hotline (24 hours) 770-488-7100. Call communicable disease epidemiology 206-361-2914 or the food program 360-586-1249. Call USDA's Meat and Poultry Hotline at 1-800-535-4555, 10 a.m. to 4 p.m., Eastern Time. In the Washington, DC area, call (202) 720-3333. TTY: 1-800-256-7072(Website7, Website8).
|
Diagnostic Tests Information
- Organism Detection Test:
- Gram Staining :
- Time to Perform: minutes-to-1-hour
- Description: Shigella cells are Gram (-) bacilli. Gram-staining is a four- part procedure which uses certain dyes to make a bacterial cell stand out against its background. The specimen should be mounted and heat fixed on a slide before you proceed to stain it(Website36, Website37).
- False Positive: Not using enough decolorizer may yield a false Gram (+) result(Website36).
- False Negative: Using too much decolorizer could result in a false Gram (-) result(Website36).
- Nucleic Acid Detection Test:
- PCR-ELISA :
- Time to Perform: 1-hour-to-1-day
- Description: Detection of PCR products of the ipaH gene from Shigella by enzyme linked immunosorbent assay (ELISA) in diarrheal stool samples. The PCR-ELISA system involves the initial amplification of the target sequence incorporating a nucleotide (dUTP) labeled with digoxigenin. This labeled target sequence is then hybridized to a complementary ipaH-derived oligonucleotide that itself is labeled with biotin. Biotin forms a strong association with streptavidin, which is commercially available on a ready made ELISA plate; thus the hybrid digoxigenin-target sequence-biotin complex is added to the ELISA plate and binds via the biotin-streptavidin interaction. Detection of the bound complex is accomplished via a simple alkaline phosphatase labeled antibody directed against digoxigenin, with color developed using a suitable substrate.Forward primer H8: GTTCCTTGACCGCCTTTCCGATACCGTCReverse primer H15: GCCGGTCAGCCACCCTCTGAGAGTAC(Sethabutr et al., 2000).
|
|
Infected Hosts Information
|
- Human
- Taxonomy Information:
- Species:
- Homo sapiens :
- Common Name: Homo sapiens
- GenBank Taxonomy No.: 9606
- Description: Only people (and possibly monkeys) can spread Shigella. Common pets, farm animals, and wild animals cannot spread these bacteria(Website3).
- Infection Process:
- Infectious Dose: Infectious dose is 10-1000 bacterial cells(Website13, Website17),
- Description: Shigella infection is characterized by invasion of the intestinal mucosa. The invasive process remains localized to the colonic and rectal mucosa, thereby causing major inflammatory destruction that accounts for a dysenteric syndrome, thus the bacillary dysentery. In many cases, however, shigellosis causes only a watery diarrhea comparable to that observed with noninvasive pathogens(Weir, 2002),
- Disease Information:
- Bacillary dysentery, Shigellosis(i.e., ) :
- Incubation: The Shigella infection incubation period is usually 16 to 72 hours (but may range 12 to 96 hours) after being exposed(Website15, Website16),
- Prognosis:
The Shigella infection is generally self-limited. The infection usually resolves in 5 to 7 days but in some persons, especially young children and the elderly, the diarrhea can be so severe that the patient requires hospitalization(Website18, Website19),
- Diagnosis Summary: The diagnosis of Shigellosis is usually made by finding Shigella bacteria in a stool sample. This is most often accomplished by collecting a stool specimen from the ill patient and sending it to a laboratory for analysis. During Shigellosis, Shigella cells are excreted in large numbers in the stool (10e6-10e8 bacterial cells per gram)(Website24, Website25, Website26),
- Symptom Information :
- Symptom -- Shigella Infection Symptoms :
- Description: Symptoms: Acute abdominal pain or cramping: This symptom is pain in the abdominal area, stomach region, or belly (often referred to as stomach pain).Tenesmus (crampy rectal pain): Tenesmus is the constant feeling of the need to empty the bowel, accompanied by pain, cramping, and involuntary straining efforts.Watery diarrhea: The passage of an increased amount of stool. This is frequently considered to be 3 or more stools per day, or excessively watery and unformed stool. Chronic diarrhea occurs when loose or more frequent stools persist for longer than two weeks.Nausea and vomiting: Nausea is the sensation leading to the urge to vomit. To vomit is to force the contents of the stomach up through the esophagus and out of the mouth.Acute fever: Normal body temperature varies amongst people, but the average is 98.6 degrees fahrenheit (37 degrees celcius). If the temperature is 99 to 100 degrees fahrenheit, this may represent a low-grade fever. Body temperature of 100 degrees fahrenheit or above is classified as fever.Blood, mucus, or pus in stool: Blood in the stool; Stool - black or tarry(Website20, Website21, Website22, Website23).
- Treatment Information:
- Oral rehydration. : Mild to moderate dehydration is common in patients with Shigellosis. Dehydration is caused by loss of fluid in stools, evaporation of water through the skin due to fever, and reduced fluid intake because of anorexia. Hyponatraemia (low levels of sodium in the blood) is a particular problem for Shigellosis. Oral rehydration therapy should be given and in most cases. Giving intravenous fluids increases the risk of infection and is expensive. Oral rehydration solution contains enough sodium to increase its level in the patient's blood, if it is low(Website27).
- Antibiotic-Ciprofloxacin. : Ciprofloxacin (Cipro) -- Fluoroquinolone with activity against streptococci, Salmonella, and most gram-negative organisms, but has no activity against anaerobes. Inhibits bacterial DNA synthesis and, consequently, bacterial growth. Adult Dose: A normal prescription of cipro would consist of 1,500mg tablet every 12 hours (2x daily) for 7-10 days. A stronger regimen of cipro would consist of 1,500mg tablet every 8 hours (3x daily) for 7-10 days.Pediatric Dose: Not recommended18 years - Administer as in adults(Website28, Website29).
- Contraindicator: Ciprofloxacin is contraindicated in patients with documented hypersensitivity(Website29).
- Complication: Coadministration with antacids, iron salts, and zinc salts may reduce serum levels; administer antacids 2-4 h before or after taking fluoroquinolones; cimetidine may interfere with metabolism of fluoroquinolones; reduces therapeutic effects of phenytoin; probenecid may increase serum concentrations; may increase toxicity of theophylline, caffeine, cyclosporine, and digoxin (monitor digoxin levels); may increase effects of anticoagulants(Website29).
- Drug Resistance: A few strains showed intermediate susceptibility to ciprofloxacin (4%) by disk diffusion test(Dutta et al., 2002).
- Antibiotic-Cotrimoxazole. : Cotrimoxazole (also called trimethoprim (TMP) - sulfamethoxazole (SMX). Sulfonamide derivative. Inhibits bacterial growth by blocking synthesis of dihydrofolic acid. Adult Dose: TMP 160mg and SMX 800mg twice a day for 5 days.Children: TMP 5mg/kg and SMX 25mg/kg twice a day for 5 days.Pediatric Dose: Less then 2 months: Not recommended.More then 2 months: 8-10 mg/kg/d PO divided bid (based on TMP component)(Website29, Website30).
- Contraindicator: Cotrimoxazole is contraindicated in patients with documented hypersensitivity(Website29).
- Complication: Coadministration with dapsone may increase blood levels of both drugs; coadministration of diuretics increases incidence of thrombocytopenia purpura in elderly patients; phenytoin levels may increase with coadministration; may potentiate effects of methotrexate in bone marrow depression; hypoglycemic response to sulfonylureas may increase with coadministration; may increase levels of zidovudine(Website29).
- Drug Resistance: Shigella resistance to cotrimoxazole was observed in 34% of the Shigella isolates(Batikhi, 2002).
- Antibiotic-Norfloxacin. : First introduced in 1986, norfloxacin belongs to a class of drugs called fluoroquinolones. Norfloxacin is a very potent antibiotic that can block the function of DNA gyrase needed for DNA replication. Dose: 400mg twice a day (interval 12 hours) for 7-10 days(Website31, Website32).
- Contraindicator: Patients hypersensitive to norfloxacin or chemically related quinolones. Pregnancy and lactation(Website33).
- Drug Resistance: Antimicrobial susceptibility testing of Shigella spp. showed a high degree of resistance to the commonly used antimicribials, including ampicillin (41%), cotrimoxazole (95%), tetracycline (87%), and nalidixic acid (59%), and low level resistance against norfloxacin (9%) and ciprofloxacin (6%)(Noyogi and Pazhani, 2003).
- Antibiotic-Ampicillin. : Used in treatment of gastroenteritis, invasive disease, and enteric fever. Adult Dose: 500-3000 mg IV q4-6h; not to exceed 12 g/d. Pediatric Dose: 200-300 mg/kg/d IV divided q6h; not to exceed 12 g/d(Website29).
- Contraindicator: Documented hypersensitivity interactions. Coadministration with allopurinol may increase risk of rash(Website29).
- Complication: Pregnancy: Usually safe but benefits must outweigh the risks. Adjust dose in renal failure; breastfeeding infants may have bowel flora modification, allergic response, and interference of culture results for fever workup(Website29).
- Drug Resistance: Shigella resistance to ampicillin was observed in 77.0% of the Shigella isolates(Batikhi, 2002).
- Prevention:
- Preventing Shigellosis
- Description: How can a Shigella infection be prevented?The spread of Shigella from an infected person can be stopped by frequent and careful hand washing with soap and water.People who have shigellosis or any diarrhea should not prepare food for others until they have been shown to no longer be carrying the bacterium. Basic food safety precautions will also help to prevent shigellosis. Shigella organisms are killed by heat used in cooking. Drink water only if it has been chlorinated (most tap water) or treated with ozone (most bottled water).Consume only pasteurized dairy products.Simple precautions taken while traveling to the developing world can prevent getting shigellosis. Drink only treated or boiled water, and eat only cooked hot foods or fruits you peel yourself. The same general precautions can prevent traveler's diarrhea caused by all pathogens(Meng and Doyle, 2002, Website12),
|
Phinet: Pathogen-Host Interaction Network
Click here to open the network web page.
|
|
Lab Animal Pathobiology & Management
NA
|
References:
Bagamboula et al., 2002: Bagamboula C, Uyttendaele M, Debevere J. Acid tolerance of Shigella sonnei and Shigella flexneri. Journal of Applied Microbiology. 2002; 93(3); 479-486. [PubMed: 12174047].
Batikhi, 2002: Batikhi M. Epidemiological study on Jordanian patients suffering from diarrhoea. The New Microbiologica. 2002; 25(4); 405-412. [PubMed: 12437219].
Dutta et al., 2002: Dutta S, Rajendran K, Roy V, Chatterjee A, Dutta P, Nair GB, Bhattacharya SK, Yoshida SI. Shifting serotypes, plasmid profile analysis and antimicrobial resistance pattern of shigellae strains isolated from Kolkata, India during 1995-2000. Epidemiology and Infection. 2002; 129(2); 235-243. [PubMed: 12403099].
Jin et al., 2002: Jin Q, Yuan Z, Xu J, Wang Y, Shen Y, Lu W, Wang J, Liu H, Yang J, Yang F, Zhang X, Zhang J, Yang G, Wu H, Qu D, Dong J, Sun L, Xue Y, Zhao A, Gao Y, Zhu J, Kan B, Ding K, Chen S, Cheng H, Yao Z, He B, Chen R, Ma D, Qiang B, Wen Y, Hou Y, Yu J. Genome sequence of Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia coli K12 and O157. Nucleic Acids Research. 2002; 30(20); 4432-4441. [PubMed: 12384590].
Kotloff et al., 1999: Kotloff K, Winickoff J, Ivanoff B, Clemens JD, Swerdlow DL, Sansonetti PJ, Adak GK, Levine MM. Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bulletin of the World Health Organization. 1999; 77(8); 651-666. [PubMed: 10516787].
Mead et al., 1999: Mead P, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C, Griffin PM, Tauxe RV. Food-related illness and death in the United States. Emerging Infectious Diseases. 1999; 5(5); 607-625. [PubMed: 10511517].
Meng and Doyle, 2002: Meng J, Doyle M. Introduction. Microbiological food safety. Microbes and Infection. 2002; 4(4); 395-397. [PubMed: 11932189].
Noyogi and Pazhani, 2003: Noyogi SK, Pazhani GP. Multiresistant Shigella Species Isolated from Childhood Diarrhea Cases in Kolkata, India. Japanese Journal of Infectious Diseases. 2003; 56; 33-34. [PubMed: 10794934].
Sethabutr et al., 2000: Sethabutr O, Venkatesan M, Yam S, Pang LW, Smoak BL, Sang WK, Echeverria P, Taylor DN, Isenbarger DW. Detection of PCR products of the ipaH gene from Shigella and enteroinvasive Escherichia coli by enzyme linked immunosorbent assay. Diagnostic Microbiology and Infectious Disease. 2000; 37(1); 11-16. [PubMed: 10794934].
Website 63: Dennis Kunkel Microscopy, Inc
Website10: Shigella fact sheet
Website11: Shigella Infection
Website12: About Shigella
Website13: Shigella summary
Website15: I. Gastrointestinal infections and diarrhea
Website16: II. Gastrointestinal infections and diarrhea
Website17: NebFacts. Shigella
Website18: I. Shigella Enteritis
Website19: The Doctor. Shigella
Website20: II. Shigella Enteritis
Website21: III. Shigella Enteritis
Website22: eMedicine. Shigella Infection
Website23: Food Safety Network. Shigella
Website24: What You should know about shigellosis
Website25: Pennhealth system
Website26: Shigella - Dysentery
Website27: Pediatrics: Vomiting, Diarrhea, and Dehydration
Website28: Antibiotics. Cipro
Website29: Salmonella, Shigella infection
Website3: Shigella an infectious foodborne illness
Website30: Shigellosis. Dialogue on diarrhea
Website31: I. Norfloxacin
Website32: II. Norfloxacin: Pharmacology
Website33: III. Norfloxacin (Noroxin)
Website34: . CDC. Agent Summary Statements Section VII-A: Bacterial Agents
Website35: Shigella Broth
Website36: Gram-staining Procedure
Website37: FDA. Microscopic Examination of Foods
Website4: World of Shigella
Website40: NCBI. Shigella flexneri 2a. Complete genome
Website41: Shigella flexneri 2a plasmid pCP301, complete sequence
Website5: Shigella picture
Website6: MicroBioNet
Website7: CDC. What to Do in an Emergency
Website8: CDC. Information networks and other information sources
Website9: Help for Shigellosis survivors
Weir, 2002: Weir E. Shigella: wash your hands of the whole dirty business. Canadian Medical Association Journal. 2002; 167(3); 281-281. [PubMed: 12186178].
Zaika, 2002: Zaika L. Effect of organic acids and temperature on survival of Shigella flexneri in broth at pH 4. Journal of Food Protection. 2002; 65(9); 1417-1421. [PubMed: 12233851].
|
Data Provenance and Curators:
PathInfo:
George Abramochkin
HazARD: (for the section of Lab Animal Pathobiology & Management)
PHIDIAS: Yongqun "Oliver" He
Link to Advanced Search on Pathogen-Host Interactions
|
|